Alt-R™ CRISPR Cas9 tracrRNA from Integrated DNA Technologies

Product Specs
ItemAlt-R™ CRISPR Cas9 tracrRNA
CompanyIntegrated DNA Technologies
Price Supplier Page View Company Product Page
Catalog Number1072532
ApplicationsGene Expression and Molecular Cloning, CRISPR
TypeCRISPR/Cas9 Vectors

Add to Compare List

Integrated DNA Technologies

1710 Commercial Park

Coralville, Iowa 52241

United States

Phone: 800-328-2661

Company Profile

Website: http://www.idtdna.com

(1) Comprehensive identification of diverse ribosomal RNA modifications by targeted nanopore direct RNA sequencing and JACUSA2RNA BiologyDecember 31, 2023Isabel S. Naarmann-de Vries, Christiane Zorbas, Amina Lemsara, Michael Piechotta, Felix G. M. Ernst, Ludivine Wacheul, Denis L. J. Lafontaine, Christoph Dieterichconcentration 4 µM) consisting of specific crRNA guides (see Table S2), a universal tracrRNA (IDT, #1072532), and the Streptococcus pyogenes Cas9 (IDT, #1081058), was electroporated in cells freshly resuspended

(2) Shuttle peptide delivers base editor RNPs to rhesus monkey airway epithelial cells in vivoNat CommunDecember 5, 2023Katarina Kulhankova, Soumba Traore, Xue Cheng, Hadrien Benk-Fortin, Stéphanie Hallée, Mario Harvey, Joannie Roberge, Frédéric Couture, Sajeev Kohli, Thomas J. Gross, et al.guide RNA (gRNA) was prepared by combining the crRNA (IDT) and tracrRNA (IDT, Coralville, IA, catalog #1072532) (Supplemental Table 4) at equimolar concentrations (100 µM), annealing at 95 °C for 5 min and renaturation

(3) NINJ1 is activated by cell swelling to regulate plasma membrane permeabilization during regulated necrosisCell Death & DiseaseNovember 18, 2023Yves Dondelinger, Dario Priem, Jon Huyghe, Tom Delanghe, Peter Vandenabeele, Mathieu J. M. Bertrandengineering via the electroporation of Cas9-RNPs. In short, 0.2 nmoles crRNA (IDT) and 0.2 nmoles tracrRNA (#1072532, IDT) were mixed, denatured at 95 °C for 5 min. and re-annealed for 20 min. at room temperature. For

(4) The homeodomain transcriptional regulator DVE-1 directs a program for synapse elimination during circuit remodelingNature CommunicationsNovember 18, 2023Kellianne D. Alexander, Shankar Ramachandran, Kasturi Biswas, Christopher M. Lambert, Julia Russell, Devyn B. Oliver, William Armstrong, Monika Rettler, Samuel Liu, Maria Doitsidou, et al.purified Alt-R S.p. Cas9 nuclease V3 100 µg (IDT CAT 1081058), Alt-R CRISPR/Cas9 tracrRNA (5 nmol, IDT CAT 1072532), and pRF-4 (rol-6 plasmid)]. Rolling worms were singled and validated by PCR sequencing. CRISPR/Cas9

(5) A beneficial adaptive role for CHOP in driving cell fate selection during ER stressbioRxiv : the preprint server for biologyOctober 23, 2023Liu K, Zhao C, Adajar RC, DeZwaan-McCabe D, Rutkowski DT.CRISPR-Cas9 tracrRNA were purchased from IDT (Alt-R® CRISPR-Cas9 crRNA; Alt-R® CRISPR-Cas9 tracrRNA (Cat# 1072532)). The crRNAs and tracrRNA were suspended in T10E0.1 and combined to 1 μg/μl (~29.5 μM) final concentration

(6) Conserved enhancers control notochord expression of vertebrate BrachyuryNature CommunicationsOctober 18, 2023Cassie L. Kemmler, Jana Smolikova, Hannah R. Moran, Brandon J. Mannion, Dunja Knapp, Fabian Lim, Anna Czarkwiani, Viviana Hermosilla Aguayo, Vincent Rapp, Olivia E. Fitch, et al.enhancer element sequences, see Supplementary Data 5. A ribonucleoprotein (RNP) complex of crRNA/TRACR (1072532, IDT) and SpCas9 protein (1081058, IDT) was electroporated into fertilized zygotes isolated from C57BL/6

(7) CFTR-rich ionocytes mediate chloride absorption across airway epitheliaJournal of Clinical InvestigationOctober 16, 2023Lei Lei, Soumba Traore, Guillermo S. Romano Ibarra, Philip H. Karp, Tayyab Rehman, David K. Meyerholz, Joseph Zabner, David A. Stoltz, Patrick L. Sinn, Michael J. Welsh, et al.are in Supplemental Tables 2 and 3. Guide RNAs were created by combining crRNA with tracrRNA (IDT, 1072532) at equimolar concentrations (100 μM), annealing them by incubating the mixture at 95°C for 10 minutes,

(8) Rare variation in noncoding regions with evolutionary signatures contributes to autism spectrum disorder riskmedRxivSeptember 26, 2023Taehwan Shin, Janet H.T. Song, Michael Kosicki, Connor Kenny, Samantha G. Beck, Lily Kelley, Xuyu Qian, Julieta Bonacina, Frances Papandile, Irene Antony, et al.concentration 20 ng/μL), hybridized sgRNA against H11 locus (Alt-R CRISPR-Cas9 tracrRNA, IDT, cat #1072532 and Alt-R CRISPR-Cas9 locus targeting crRNA, gctgatggaacaggtaacaa, total final concentration 50 ng/μL)

(9) Inducing multiple nicks promotes interhomolog homologous recombination to correct heterozygous mutations in somatic cellsNature communicationsSeptember 15, 2023Tomita A, Sasanuma H, Owa T, Nakazawa Y, Shimada M, Fukuoka T, Ogi T, Nakada S.(rArGrCrArUrArGrCrArArGrUrUrArArArArUrArArGrGrCrUrArGrUrCrCrGrUrUrArUrCrArArCrUrUrGrArArArArArGrUrGrGrCrArCrCrGrArGrUrCrGrGrUrGrCrUrUrU, rN: RNA base, #1072532) and customized Alt-R CRISPR-Cas9 gRNA were purchased from IDT. The target sequences of sgRNAs and gRNAs

(10) Generation of a tyrosine hydroxylase-2A-Cre knockin non-human primate model by homology-directed-repair-biased CRISPR genome editingCell Reports MethodsSeptember 14, 2023Sho Yoshimatsu, Junko Okahara, Junko Yoshie, Yoko Igarashi, Ryusuke Nakajima, Tsukasa Sanosaka, Emi Qian, Tsukika Sato, Hiroya Kobayashi, Satoru Morimoto, et al.Alt-R™ S.p. Cas9 Nuclease V3,IDT,Cat#1081058 Cas9-DN1S,Jayavaradhan et al.20,N/A Custom Alt-R™ CRISPR-Cas9 guide RNA,IDT,N/A Alt-R® CRISPR-Cas9 tracrRNA,IDT,Cat#1072532 (RAD51-134H) Recombinant Human RAD51,Creative Biomart,Cat#RAD51-134H ,, Critical commercial assays,Critical

(11) Protocol for generating monoclonal CRISPR-Cas9-mediated knockout cell lines using RNPs and lipofection in HNSCC cellsSTAR ProtocolsSeptember 1, 2023Fabian Geyer, Maximilian Geyer, Sarah Klapproth, Klaus-Dietrich Wolff, Markus NieberlerCVCL_1283 ,, Oligonucleotides,Oligonucleotides,Oligonucleotides ,, Alt-R® CRISPR-Cas9 crRNA,IDT™,N/A Alt-R® CRISPR-Cas9 tracrRNA,IDT™,1072532 CHD4#1 crRNA: GCTATGGGATAAAACCCGAG,This paper,N/A CHD4#2 crRNA: TCGAACCCTCACCAACTACA,This paper,N/A CHD4#3

(12) The E3/E4 ubiquitin ligase UFD-2 suppresses normal and oncogenic signaling mediated by a Raf ortholog in Caenorhabditis elegansScience SignalingAugust 29, 2023Robert Townley, Augustin Deniaud, Kennedy S. Stacy, Claudia S. Rodriguez Rodriguez Torres, Fatemeh Cheraghi, Nicole B. Wicker, Claire C. de la Covaof California Berkeley), 100 ng/μL Alt-R-Crispr-Cas9 tracrRNA (Integrated DNA Technologies catalog 1072532), and 55 ng/μL custom gene-specific Alt-R crRNA synthesized by Integrated DNA Technologies, 2.5 ng/μL

(13) Nonsense-mediated decay machinery in Plasmodium falciparum is inefficient and non-essentialmSphereAugust 24, 2023Emma McHugh, Michaela S. Bulloch, Steven Batinovic, Cameron J. Patrick, Drishti K. Sarna, Stuart A. Ralphtransfection, gene-specific crRNA (100 µM in Tris-EDTA) and tracrRNA (100 µM in Tris-EDTA, catalog number 1072532) were annealed to form gRNA (Integrated DNA Technologies) by mixing 1:1, heating to 95°C for 5 min and

(14) Plasmodium falciparum formins are essential for invasion and sexual stage developmentCommun BiolAugust 18, 2023Sophie Collier, Emma Pietsch, Madeline Dans, Dawson Ling, Tatyana A. Tavella, Sash Lopaticki, Danushka S. Marapana, Mohini A. Shibu, Dean Andrew, Snigdha Tiash, et al.Integrated DNA Technologies as an Alt-R CRISPR-Cas9 crRNA guide; duplexed with the Alt-R CRISPR-Cas9 tracerRNA (IDT, 1072532) and complexed with the Alt-R S.p. Cas9 Nuclease V3 (IDT, 1081058) following the manufactures instructions.

(15) Praziquantel inhibits Caenorhabditis elegans development and species-wide differences might be cct-8-dependentPLoS OneAugust 10, 2023Janneke Wit, Clayton M. Dilks, Gaotian Zhang, Karen S. Kim Guisbert, Stefan Zdraljevic, Eric Guisbert, Erik C. Andersenstrategy [33]. ALT-R and tracrRNA were purchased from IDT (Skokie, IL) (S2 Table). The tracrRNA (IDT, 1072532) was injected at a final concentration of 13.6 μM. The crRNA for dpy-10 was injected at 4 μM, and the

(16) Genetic manipulation of betta fishFrontiers in Genome EditingJuly 21, 2023Alec Palmiotti, Madison R. Lichak, Pei-Yin Shih, Young Mi Kwon, Andres Bendesky(crRNAs) (Alt-R® CRISPR-Cas9 crRNA XT, 2 nmol, Integrated DNA Technologies, Coralville, IA) and tracrRNA (1072532, Alt-R® CRISPR-Cas9 tracrRNA, 5 nmol, Integrated DNA Technologies) to a working concentration of 100

(17) Polarized localization of kinesin-1 and RIC-7 drives axonal mitochondria anterograde transportbioRxivJuly 18, 2023Youjun Wu, Chen Ding, Alexis Weinreb, Laura Manning, Grace Swaim, Shaul Yogev, Daniel A. Colón-Ramos, Marc Hammarlund2018. The injection mix contains 0.25 μg/μl S.pyogenes Cas9 (IDT# 1081058), 0.1 μg/μl tracrRNA (IDT# 1072532), 0.056 μg/μl crRNA in total (0.028 μg/μl for each sequence, synthesized by IDT), and 40ng/μl PRF4 (rol-6

(18) Forkhead transcription factor FKH-8 cooperates with RFX in the direct regulation of sensory cilia in Caenorhabditis eleganseLifeJuly 14, 2023Rebeca Brocal-Ruiz, Ainara Esteve-Serrano, Carlos Mora-Martínez, Maria Luisa Franco-Rivadeneira, Peter Swoboda, Juan J Tena, Marçal Vilar, Nuria Flames#1081058) and the universal trans-activating crRNA (tracrRNA) needed to initiate enzymatic activity (IDT, #1072532) were used. co-CRISPR injections were performed on young adult hermaphrodites expressing the reporter

(19) Conserved enhancer logic controls the notochord expression of vertebrate BrachyurybioRxivJune 27, 2023Cassie L. Kemmler, Jana Smolikova, Hannah R. Moran, Brandon J. Mannion, Dunja Knapp, Fabian Lim, Anna Czarkwiani, Viviana Hermosilla Hermosilla Aguayo, Vincent Rapp, Olivia E. Fitch, et al.enhancer element sequences, see Supplemental Table 5. A ribonucleoprotein (RNP) complex of crRNA/TRACR (1072532, Integrated DNA technologies) and SpCas9 protein (1081058, Integrated DNA technologies) was electroporated

(20) Deciphering D4Z4 CpG methylation gradients in fascioscapulohumeral muscular dystrophy using nanopore sequencingbioRxivJune 24, 2023Russell J Butterfield, Diane M Dunn, Brett Duvall, Sarah Moldt, Robert B WeissKit (Oxford Nanopore Technologies, cat # SQK-CS9109). crRNAs are annealed with tracrRNA (IDT, cat # 1072532) by combining: 1 μL of 100μM of crRNA pooled oligonucleotides (see Supplemental Table S7 for sequences),

Be the First to Write a Review!

Alt-R™ CRISPR Cas9 tracrRNA from Integrated DNA Technologies

Description

Integrated DNA Technologies

Citations (173)

Reviews

Alt-R™ CRISPR Cas9 tracrRNA from Integrated DNA Technologies

About Biocompare

Advertise with Us

Specialized Search Tools

Site Map